Addgene: Reduced Expression GFP beta actin
β-actin gene sequence and position of the forward and reverse primers... | Download Scientific Diagram
JCI Insight - Brd4-p300 inhibition downregulates Nox4 and accelerates lung fibrosis resolution in aged mice
Time for rethinking the different β‐actin transgenic mouse models? - Vanslembrouck - 2020 - Cytoskeleton - Wiley Online Library
beta Actin (ACTB) Human qPCR Primer Pair (NM_001101) – HP204660 | OriGene
Table S1. Sequence of primers used in real-time PCR Forward Primer Reverse Primer Human IL1β AGCTACGAATCTCCGACCAC CGTTATCCCATG
Time for rethinking the different β‐actin transgenic mouse models? - Vanslembrouck - 2020 - Cytoskeleton - Wiley Online Library
Beta-Actin - an overview | ScienceDirect Topics
Addgene: eTC GFP beta-actin full length
Human beta-Actin qPCR Primer Pair | Sino Biological
Design and Testing of β-Actin Primers for RT-PCR that Do Not Co-amplify Processed Pseudogenes
Selective measurement of α smooth muscle actin: why β-actin can not be used as a housekeeping gene when tissue fibrosis occurs | BMC Molecular Biology | Full Text
Primer sequences of C4A, C4B, CTins and Beta-actin qPCR runs. | Download Table
Frontiers | β-Actin: Not a Suitable Internal Control of Hepatic Fibrosis Caused by Schistosoma japonicum
β-actin dependent chromatin remodeling mediates compartment level changes in 3D genome architecture | Nature Communications
xmlinkhub
PCR primers and primer sequences used to amplify EF1A, EF2, and b-actin... | Download Table
Tables_Page_2.jpg
Product Manual Human beta actin RT-PCRmer™
β-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels | Thorax
WJMH :: The World Journal of Men's Health
Primer and probe sequences for tPA, uPA, PAI-1 and b-actin for RT-PCR | Download Table
Forward (F) and Reverse (R) Primer Sequences of β-actin and hTERT Used... | Download Scientific Diagram
Different translation dynamics of β- and γ-actin regulates cell migration | eLife
Table S1. Sequence of primers used in real-time PCR Forward Primer Reverse Primer Human IL1β AGCTACGAATCTCCGACCAC CGTTATCCCATG
Sequence or primers used for qPCR analysis Name β-actin gene Forward... | Download Table
Frontiers | β-Actin: Not a Suitable Internal Control of Hepatic Fibrosis Caused by Schistosoma japonicum
Design and Testing of β-Actin Primers for RT-PCR that Do Not Co-amplify Processed Pseudogenes
The Early-Onset Myocardial Infarction Associated PHACTR1 Gene Regulates Skeletal and Cardiac Alpha-Actin Gene Expression | PLOS ONE
